Nucleocapsid (N) Expression Vector
Product | Unit size | Cat. code | Docs. | Qty. | Price | |
---|---|---|---|---|---|---|
pUNO1-SARS2-N SARS-CoV-2 N gene |
Show product |
20 µg |
puno1-cov2-n
|
|
SARS-CoV-2 Nucleocapsid coding sequence
GENE DESCRIPTION
Nucleocapsid (N) is a phosphoprotein that associates with the viral RNA genome and forms the ribonucleoprotein core [1]. N features two RNA-binding domains in N-terminal and C-terminal. Each domain supports distinct functions, including RNA chaperoning, incorporation, and packing as a helical "beads-on-a-string" conformation [1, 2].
pUNO1-SARS2-N contains the wild-type coding sequence of SARS-CoV-2 Nucleocapsid. (See Details and Specifications for more information).
Schematic of SARS-CoV-2 nucleocapsid expression vector
InvivoGen also offers:
• SARS-CoV-2-Cellular Receptor Genes
• SARS-CoV-2 S, S1, RBD, M, E Genes
PLASMID DESCRIPTION
pUNO1-SARS2-N features a potent mammalian expression cassette comprised of the ubiquitous human EF1α-HTLV composite promoter and the SV40 polyadenylation (pAn) signal. The ORF is flanked by unique restriction sites (AgeI and NheI) to facilitate its subcloning. The plasmid is selectable with blasticidin in both E. coli and mammalian cells. It can be used for transient or stable transfection. It contains no tag.
QUALITY CONTROL
- Fully sequenced ORF
- Predominant supercoiled conformation
Learn more about SARS-CoV-2 infection cycle, immune responses, and potential therapeutics.
References
1. Chang C et al., 2006. Modular organization of SARS coronavirus nucleocapsid protein. J. Biom. Sci. 13:59-72.
2. Neuman B.W. & Buchmeier M.J., 2016. Supramolecular architecture of the coronavirus particle. Advances in virus research. 96:1-27.
Specifications
- Strain: Wuhan-Hu-1 isolate
- Genbank: NC_045512.2
- ORF size from ATG to Stop codon: 1260 bp
- Native (wild-type) sequence
-
Subcloning restriction sites in pUNO1: AgeI (in 5’) and NheI (in 3’)
- AgeI generates cohesive ends compatible with XmaI, BspEI, NgoMIV, and SgrAI restriction sites
- NheI generates cohesive ends compatible with AvrII, SpeI, and XbaI restriction sites -
Sequencing primers:
- Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
- Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
Contents
- 20 μg of lyophilized DNA
- 2 x 1 ml blasticidin at 10 mg/ml
The product is shipped at room temperature.
Lyophilized DNA should be stored at -20 ̊C.
Resuspended DNA should be stored at -20 ̊C and is stable up to 1 year.
Blasticidin is a harmful compound. Refer to the safety data sheet for handling instructions.
Store blasticidin at 4°C or -20°C for up to two years. The product is stable for 2 weeks at 37°C.
Avoid repeated freeze-thaw cycles.
Back to the top