ODN 2006 control (ODN 2137)
| Product | Unit size | Cat. code | Docs. | Qty. | Price | |
|---|---|---|---|---|---|---|
|
ODN 2006 control (ODN 2137) Negative control for ODN 2006 |
Show product |
1 mg |
tlrl-2006c-1
|
|
You may also need :
ODN 2006 (ODN 7909)
|
View more associated products ▼
Negative control for ODN 2006
ODN 2006 Control (ODN 2137) contains GpC dinucleotides instead of CpGs and can be used as a negative control for ODN 2006 (type B, with a preference for human TLR9).
Back to the topSpecifications
Synonym: ODN 2137
Working concentration: 5 µM (10 μg/ml)
Solubility: 5 mg/ml in water
ODN 2006 Control sequence : 5’- tgctgcttttgtgcttttgtgctt -3’ (24 mer)
Note: Bases are phosphorothioate (nuclease resistant).
Quality control:
- The absence of bacterial contamination (e.g. lipoproteins and endotoxins) has been confirmed using HEK-Blue™ TLR2 and HEK-Blue™ TLR4 cells.
Contents
- 1 mg (130 nmol) lyophilized ODN 2006 Control (ODN 2137)
- 1.5 ml sterile endotoxin-free water
ODN 2006 Control (ODN 2137) is shipped at room temperature.
Upon receipt, store at -20 °C.