3p-hpRNA - RIG-I agonist
Product | Unit size | Cat. code | Docs. | Qty. | Price | |
---|---|---|---|---|---|---|
3p-hpRNA 5’ triphosphate hairpin RNA |
Show product |
25 µg 4 x 25 µg |
tlrl-hprna
|
|
RIG-I agonist
3p-hpRNA structure and signaling
3p-hpRNA is a 5’ triphosphate hairpin RNA that was generated by in vitro transcription of a sequence from the influenza A (H1N1) virus, a single‑stranded negative‑sense RNA virus [1,2]. This 89-mer RNA oligonucleotide contains an uncapped 5’ triphosphate extremity and a double-strand fragment. 3p-hpRNA sequence self-anneals to form secondary structures such as hairpin or panhandle conformations. These structural features, which distinguish viral RNA from mammalian RNA, are recognized by retinoic acid-inducible gene I (RIG‑I) [3,4]. RIG-I is a cytoplasmic RNA helicase that belongs to the RIG-I-like receptors (RLRs) family and triggers an antiviral immune response by the activation of type-I interferons (IFN-α and -β) [5].
To achieve stimulation of RIG-I, 3p-hpRNA must be delivered into the cytoplasm, for example by using a transfection agent, such as LyoVec™. Of note, this ligand induces stronger RIG-I responses than 5’ppp‑dsRNA, a fully synthetic RIG-I ligand.
Key Features of 3p-hpRNA:
- 3p-hpRNA is a specific RIG-I agonist
- Stronger RIG-I responses than 5’ppp‑dsRNA
- Its biological activity has been verified using our RLR reporter cell lines.
COVID-19 related research
Type I interferons (IFNα/β) are the prototypical antiviral cytokines. Inducers of these cytokines, such as the RIG-I agonist, 3p-hpRNA a 5’ triphosphate hairpin RNA, can be used to study the innate immune response to SARS-CoV-2.
References:
1. Rehwinkel J. et al., 2010. RIG-I detects viral genomic RNA during negative-strand RNA virus infection. Cell. 140:397-408.
2. Liu G. et al., 2015. Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and IFN Induction. J Virol. 89(11):6067-79.
3. Hornung V. et al., 2006. 5’-triphosphate RNA is the ligand for RIGI. Science. 314:994-7.
4. Gebhardt A. et al., 2017. Discrimination of Self and Non-Self Ribonucleic Acids. Journal of IFN & Cytokine Research 37: 184-97.
5. Yoneyama M. et al., 2015. Viral RNA detection by RIG-I-like receptors. Curr Opin Immunol. 32:48-53.
Read our review on RIG-I and cancer immunotherapy.
Specifications
Specificity: RIG-I agonist
Sequence:
5’-pppGGAGCAAAAGCAGGGUGACAAAGACAUAAUGGAUCCAAACACUGUGUCAAGCUUUCAGGUAGAUUGCUUUCUUUGGCAUGUCCGCAAAC- 3’ (89 mer)
3p-hpRNA was prepared by in vitro transcription with T7 RNA polymerase. This sequence self-anneals to form secondary structures such as hairpin or panhandle conformations.
Formulation: Naked
Working Concentrations: 10 ng- 1 μg/ml
Quality Control:
- The biological activity has been verified using cellular assays.
- The absence of bacterial contamination (lipoproteins and endotoxins) has been confirmed using HEK-Blue™ TLR2 and HEK-Blue™ TLR4 cells.
Back to the top
Contents
3p-hpRNA is available in two quantities:
tlrl-hprna:
- 25 μg 3p-hpRNA (naked).
- 1.5 ml sterile endotoxin-free water.
tlrl-hprna-100:
- 4 x 25μg 3p-hpRNA (naked).
- 10 ml sterile endotoxin-free water.
3p-hpRNA is provided lyophilized and shipped at room temperature.
Store lyophilized 3p-hpRNA at -20°C.
Lyophilized product is stable for 1 year when stored -20°C.