HSV-60 - CDS Agonist

Synthetic HSV-1 DNA analog

ABOUT

CDS Agonist

HSV-60 is a 60 bp oligonucleotide containing viral DNA motifs that derive from the herpes simplex virus 1 (HSV-1) genome [1].  Transfected HSV-60 potently induces an immune response following recognition by the cytosolic DNA sensors (CDSs), DEAD-box protein 41 (DDX41) [2] or interferon γ-inducible protein 16  (IFI16) [1]. IFI16 induces innate immune responses against single-stranded (ss)and double-stranded (ds) intracellular DNA while DDX41 detects not only viral dsDNA but also bacterial cyclic dinucleotides. DDX41 and IFI16 activation trigger type I interferon (IFN) induction via the STING/TBK1 pathway.

More details

 

Mode of action:

Intracellular DNA from pathogens is recognized by multiple CDSs, which display contextual preferences for the recognition of DNA [1].
Transfected HSV-60 has been shown to potently induce IFN-β in a Toll-like receptor (TLR)-, DNA-dependent activator of IRFs (DAI)-, and RNA polymerase III (Pol III)-independent, but STING-, TBK1- and IFN regulatory factor 3 (IRF3)-dependent manner [1,2]. Studies have demonstrated that transfected HSV-60 is recognized by DDX41 [2] and IFI16 [1].

In order to facilitate its intracellular delivery, HSV-60 should be complexed with a cationic lipid transfection agent, such as LyoVec™.

Key features of HSV-60:

  • Potent inducer of type I IFNs
  • Available complexed with the cationic lipid LyoVec™
  • Each lot is functionally validated

 

Read our review on cytosolic DNA sensors

 

References:

1. Unterholzner L. et al., 2010. IFI16 is an innate immune sensor for intracellular DNA. Nat Immunol. 11(11):997-1004.
2. Zhang Z. et al., 2011. The helicase DDX41 senses intracellular DNA mediated by the adaptor STING in dendritic cells. Nat Immunol.12(10):959-65.

All products are for research use only, and not for human or veterinary use.

CDS activation with intracellular HSV-60
CDS activation with intracellular HSV-60

SPECIFICATIONS

Specifications

Sequence

5’  TAAGACACGATGCGATAAAATCTGTTTGTAAAATTTATTAAGGGTACAAATTGCCCTAGC  3’
3’   ATTCTGTGCTACGCTATTTTAGACAAACATTTTAAATAATTCCCATGTTTAACGGGATCG   5’

Formulation buffer

Naked

Tested applications

Cellular assays

Quality control

Each lot is functionally tested and validated.

CONTENTS

Contents

  • Product: 
    HSV-60 Naked
  • Cat code: 
    tlrl-hsv60n
  • Quantity: 
    200 µg
Includes:

1.5 ml endotoxin-free water

Shipping & Storage

  • Shipping method:  Room temperature

    • Storage:

    • -20°C

Details

IFI16

IFN γ-inducible protein 16 (IFI16) and its murine orthologue p204 induce innate immune responses against single-stranded (ss) and double-stranded (ds) cytosolic DNA [1,2]. Located predominantly in the nucleus and in small fractions in the cytoplasm, IFI16 can function to activate type I interferon (IFN) responses via STING-mediated phosphorylation of TBK1 and IFN regulatory factor 3 (IRF3) [3]. IFI16 has been reported to sense the DNA of several viruses such as herpesviruses (HSV), cytomegalovirus, and Epstein-Barr virus [1].

DDX41

DEAD-box protein 41 (DDX41) has been shown to induce IFN-β responses upon stimulation with poly(dA:dT), HSV-1, Listeria monocytogenes, and adenovirus [4,5].  This IFN-β induction by DDX41 has been shown to occur via the STING/TBK1/IRF3 signaling pathway. DDX41 was also found to bind to and control the IFN response to cyclic-dinucleotides (CDNs) such as cyclic-di-AMP and cyclic-di-GMP [6].

 

Reference:

1. Zahid A. et al, 2020. Molecular and Structural Basis of DNA Sensors in Antiviral Innate Immunity. Front Immunol. 2020 Nov 30;11:613039.
2. Unterholzner L. et al., 2010. IFI16 is an innate immune sensor for intracellular DNA. Nat Immunol. 11(11):997-1004.
3. Stratmann S.A. et al., 2015. The innate immune sensor IFI16 recognizes foreign DNA in the nucleus by scanning along the duplex. Elife (2015) 4:e11721.
4. Zhang Z. et al., 2011. The helicase DDX41 senses intracellular DNA mediated by the adaptor STING in dendritic cells. Nat Immunol.12(10):959-65.
5. Stein S.C.& Falck-Pedersen E., 2012. Sensing adenovirus infection: activation of interferon regulatory factor 3 in RAW 264.7 cells. J Virol. 86:4527–4537.
6. Parvatiyar K. et al., 2012. The helicase DDX41 recognizes the bacterial secondary messengers cyclic di-GMP and cyclic di-AMP to activate a type I interferon immune response. Nat Immunol. 13:1155–1161.

DOCUMENTS

Documents

HSV-60 Naked

Technical Data Sheet

Safety Data Sheet

Certificate of analysis

Need a CoA ?

Contact us

Citations

CUSTOMER SERVICE & TECHNICAL SUPPORT

Question about this product ?