G3-YSD Control
| Product | Unit size | Cat. code | Docs. | Qty. | Price | |
|---|---|---|---|---|---|---|
|
G3-YSD Control Control for cGAS Agonist G3-YSD |
Show product |
200 µg |
tlrl-ydnac
|
|
No cGAS activation with G3-YSD Control
Negative control for G3-YSD
G3-YSD Control is a negative control for G3-YSD, a potent cGAS (cyclic GMP-AMP synthase, cGAMP synthase) agonist. This negative control differs from the G3-YSD agonist in the hairpin-flanking nucleoside trimers. While G3-YSD is flanked with guanosine trimers (G3) conferring its agonist activity, G3-YSD Control is flanked with cytidine trimers (C3) abrogating cGAS activation [1]. cGAS is a critical cytosolic DNA sensor that triggers innate immune responses through the production of type I interferons (IFNs) [1].
Mode of action:
cGAS detects double-stranded DNA (dsDNA) over 40 bp in length, or stem-loop structures of single-stranded DNA (ssDNA) flanked by unpaired nucleotides [1-3]. Interaction of cGAS with its agonists promotes the synthesis of 2’3’-cGAMP, a second messenger that activates STING (stimulator of interferon genes), and the downstream production of type I interferons (IFNs) and other cytokines [2].
In THP1-Dual™ reporter cells, which express multiple cytosolic DNA sensors including cGAS, intracellular G3-YSD Control (C3-ended Y-form Short DNA) does not activate an interferon regulatory factor (IRF) response compared to intracellular G3-YSD (see figure).
Key features of G3-YSD Control:
- Negative control for G3-YSD
- Y-form Short DNA flanked with cytidine trimers
- Each lot is functionally tested
Read our review on cGAS.
References:
1. Herzner A.M. et al., 2015. Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA. Nat Immunol. 16(10):1025-33.
2. Li T. & Chen Z.J., 2018. The cGAS-cGAMP-STING pathway connects DNA damage to inflammation, senescence, and cancer. J Exp Med.215(5):1287-1299.
3. Luecke S. et al., 2017. cGAS is activated by DNA in a length-dependent manner. EMBO Rep. 18(10):1707-1715.
Figures
Specifications
Activity: Control for G3-YSD (cGAS agonist)
Working concentration: 100 ng - 1 μg/ml
Sequence: 5’ CCC TATATATATGCATATATATA CCC 3’ (26 mer)
Note: G3-YSD Control contains a palindromic sequence for which self-hybridization results in double-stranded DNA. The flanking cytidine trimers in 5' and 3' remain unpaired.
Molecular weight: 7843.3 g/mol
Quality control:
- The inability to induce type I interferon has been verified using cellular assays.
- The absence of bacterial contamination, such as lipoproteins and endotoxins, has been confirmed using HEK-Blue™ TLR2 and HEK-Blue™ TLR4 cells.
Contents
- 200 μg G3-YSD Control (C3-ended Y-form Short DNA)
- 1.5 ml sterile endotoxin-free water
G3-YSD Control is shipped at room temperature.
Upon receipt, store at -20°C.
Resuspended product is stable for 12 months at -20°C.
Avoid repeated freeze-thaw cycles.
Details
cGAS
Cyclic GMP-AMP synthase (cGAS, cGAMP synthase) is a critical cytosolic DNA sensor that triggers innate immune responses through the production of type I interferons (IFNs) [1]. In response to cytosolic double‑stranded DNA (dsDNA), cGAS produces the cyclic dinucleotide (CDN) 2’3’-cGAMP.
CDNs bind directly to STING, leading to TBK1‑IRF3-mediated activation of IFN-stimulated response elements (ISRE) in the promoters of IFN-stimulated genes (ISG). The most potent agonist of human STING is 2’3’-cGAMP [2,3].
References:
1. Sun L. et al., 2013. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339(6121):786-91.
2. Gao P. et al., 2013. Cyclic [G(2’,5’)pA(3’,5’)p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase. Cell. 153(5):1094-107.
3. Ablasser A. et al., 2013. cGAS produces a 2’-5’-linked cyclic dinucleotide second messenger that activates STING. Nature. 498(7454):380-4.