Human TLR9 Agonist Kit

CpG-ODN Classes

Set of known agonists for human TLR9

This kit features the most widely known CpG ODNs from Class A, B, or C that function best with human cells. These CpG ODNs are often cited in the literature.

Choose the most suitable class of ODN for your studies, from:

• ODN 2216 and ODN 2243 (ODN 2216 control) A-class
• ODN 2006 and ODN 2006 control B-class
• ODN 2395 and ODN 2395 control C-class

 More details

Read our review about TLR9 agonists.

Specifications

Specificity: Human TLR9 agonists

Quality control:

• TLR9 activity has been tested using HEK-Blue™ TLR9 cells.
• The absence of bacterial contamination (e.g. lipoproteins and endotoxins) has been confirmed using HEK-Blue™ TLR2 and HEK-Blue™ TLR4 cells.

Sequences:
ODN 2006 (class B): 5’- tcgtcgttttgtcgttttgtcgtt-3’ (24 mer)
ODN 2006 Control: 5’- tgctgcttttgtgcttttgtgctt-3’ (24 mer)
ODN 2216 (class A): 5’- ggGGGACGA:TCGTCgggggg-3’ (20 mer)
ODN 2243 (ODN 2216 Control): 5’- ggGGGAGCATGCTGgggggg-3’ (20 mer)
ODN 2395 (class C): 5’- tcgtcgttttcggcgc:gcgccg-3’ (22 mer)
ODN 2395 Control: 5’- tgctgcttttggggggcccccc -3’ (22 mer)
Note: Bases shown in capital letters are phosphodiester, those in lower case are phosphorothioate (nuclease resistant) and palindrome is underlined.

Contents

ODNs are provided lyophilized:

• 100 μg (13.0 nmol) ODN 2006 (ODN 7909)
• 100 μg (13.0 nmol) ODN 2006 Control (ODN 2137)
• 100 μg (15.5 nmol) ODN 2216
• 100 μg (15.5 nmol) ODN 2243 (ODN 2216 Control)
• 100 μg (14.2 nmol) ODN 2395
• 100 μg (14.2 nmol) ODN 2395 Control
• 1.5 ml endotoxin-free water

Products are shipped at room temperature.

Upon receipt, it should be stored at -20°C.

Details

CpG ODNs are synthetic oligonucleotides that contain unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs). These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian DNA [1]. CpG ODNs are recognized by Toll-like receptor 9 (TLR9) leading to strong immunostimulatory effects.

• ODN2006 (also known as ODN 7909 or PF-3512676) is a class B CpG ODN with a preference towards human TLR9. Class B CpG ODNs contain a full phosphorothioate backbone with one or more CpG dinucleotides. They strongly activate B cells but weakly stimulate IFN-α secretion.

• ODN 2006 Control (also known as ODN 2173) contains GpC dinucleotides instead of CpGs and can be used as a negative control together with ODN 2006. Note: In some cell types, ODN 2006 Control may stimulate cell activity, including the production of cytokines [2].

• ODN 2216 is a CpG ODN class A with a preference towards human TLR9. Class A CpG ODNs are characterized by a phosphodiester central CpG-containing palindromic motif and a phosphorothioate 3’ poly-G string. They induce high IFN-α production from plasmacytoid dendritic cells (pDC) but are weak stimulators of TLR9-dependent NF-kB signaling.

• ODN 2243 (also known as ODN 2216 Control) contains GpC dinucleotides instead of CpGs and can be used as a negative control together with ODN 2216.

• ODN 2395 is a CpG ODN class C for human and mouse TLR9. Class C CpG ODNs combine features of both classes A and B. They contain a complete phosphorothioate backbone and a CpG-containing palindromic motif. Class C CpG ODNs induce strong IFN-α production from pDC and B cell stimulation.

• ODN 2395 Control contains GpC dinucleotides instead of CpGs and can be used as a negative control with ODN 2395.

1. Bauer, S. et al., 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. PNAS 98(16):9237-42.
2. Reid G. et al., 2005. CpG stimulation of precursor B-lineage acute lymphoblastic leukemia induces a distinct change in costimulatory molecule expression and shifts allogeneic T cells toward a Th1 response. Blood 105(9):3641-7.