D614G Variant Spike Expression Vectors

Optimized SARS-CoV-2 Spike (G614 Variant) gene for mammalian cell expression

pUNO1-SpikeV1 and pUNO1-SpikeV1-dfur plasmids have been specifically designed for the expression of the SARS-CoV-2 Spike (S) protein in mammalian cells. These plasmids encode the full-length Spike sequence from the original isolate with the D614G mutation, and for optimal cellular expression, it is codon-optimized and the C‑terminal ER-retention signal has been removed [1, 2].

Spike G614-variant expression vectors
for cell fusion and flow cytometry assays

Gene Description

These plasmids encode the Spike protein from the original SARS-CoV-2 isolate, first identified in Wuhan in December 2019, with the D614G mutation. Since April 2020, this signature mutation has globally replaced the original sequence and is present in all subsequent variants of SARS-CoV-2 from Clade 20/Lineage B (Nextstrain/Pango lineage classification) [3].

• S1 domain: D614G

Learn more about SARS-CoV-2 Variants

The Spike protein contains a furin cleavage site that can affect its cellular expression [4, in-house data]. Therefore, depending on your application InvivoGen offers:

• pUNO1-SpikeV1: with a functional furin cleavage site and recommended for Spike/ACE2 cell fusion assays
• pUNO1-SpikeV1-dfur: with an inactive furin (dfur) cleavage site for improved surface expression and detection (flow cytometry)

 More details

General Plasmid Description

These plasmids feature a potent mammalian expression cassette composed of the ubiquitous human EF1α-HTLV composite promoter and the SV40 polyadenylation (pAn) signal.  The codon-optimized ORF includes the native SARS-CoV-2 Spike signal sequence. The plasmids are selectable with Blasticidin in both E. coli and mammalian cells (transient and stable transfection).

Applications

• Spike-mediated cell fusion assays with pUNO1-SpikeV1
• Cell surface detection by flow cytometry with pUNO1-SpikeV1-dfur
• Screening of SARS-CoV-2 inhibitors including small molecules, monoclonal antibodies, or convalescent plasma

References:

1. Johnson, M.C. et al. 2020. Optimized Pseudotyping Conditions for the SARS-COV-2 Spike Glycoprotein. J Virol 94.
2. Ou, X. et al. 2020. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620.
3. Korber B.et al. 2020. Tracking changes in SARS-CoV-2 Spike: evidence that D614G increases infectivity of the COVID‑19 virus. Cell. 182:1-16.
4. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.

Specifications

pUNO1-SpikeV1

• Origin: Wuhan-Hu-1 isolate
• Sequence Reference: NC_045512.2 (with D614G mutation)
• Codon optimized
• ORF size: 3765 bp
• Sequencing primers:
  - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
  - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
• Quality Control:
  - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
  - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.

pUNO1-SpikeV1-dfur

• Origin: Wuhan-Hu-1 isolate
• Sequence Reference: NC_045512.2 (with D614G mutation)
• Codon optimized and R683/5A mutations
• ORF size: 3765 bp
• Sequencing primers:
  - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
  - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
• Quality Control:
  - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
  - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.

Contents

pUNO1-SpikeV1 and pUNO1-SpikeV1-dfur are provided as follows:

Please note: Each plasmid is sold separately. 

• 20 μg of lyophilized DNA
• 2 x 1 ml Blasticidin at 10 mg/ml

 The product is shipped at room temperature.

Lyophilized DNA should be stored at -20 °C.

Resuspended DNA should be stored at -20 °C and is stable for up to 1 year.

Blasticidin is a harmful compound. Refer to the safety data sheet for handling instructions. Store Blasticidin at 4 °C or -20 °C for up to two years. The product is stable for 2 weeks at 37 °C.

Avoid repeated freeze-thaw cycles.

Details

Furin cleavage site in the SARS-CoV-2 Spike protein

A furin cleavage sequence (RRxR) is found within a polybasic cleavage site (681-PRRSR/SVA-688) at the boundary between the S1 and S2 domains (S1/S2) of the Spike protein [1]. Furin is enriched in the Golgi apparatus, where it functions to cleave proteins into their 'mature/active forms'. Specifically, it is suggested that cleavage at this site by furin pre-primes the SARS-CoV-2 S protein during its production. This allows further processing by cell surface host proteases (e.g. TMPRSS2)  upon binding to ACE2, which ultimately facilitates viral-host membrane fusion [2,3].

► In a mammalian expression system (e.g. HEK293 cells), to maximize the surface expression of the S protein, the furin cleavage site in InvivoGen's pUNO1-SpikeV1-dfur has been inactivated (in-house data). The crucial recognition residues have been mutated (R683A and R685A) ensuring that the S protein is not cleaved by furin. 

Furthermore, the S protein possesses cell-cell fusogenic activity and has been shown to trigger large syncytia formation (multi-nucleated cells). Notably, overexpression of an uncleavable S protein (mutated/inactivated furin cleavage site) has been shown to not induce cell-cell fusion, suggesting that cleavage at the multibasic site is a requirement for syncytia formation [3].

► To study cell-cell fusion by the SARS-CoV-2 spike, InvivoGen offers the pUNO1-SpikeV1 plasmid.

References:

1. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.
2. Johnson, B.A. et al. 2021. Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis. Nature
3. Papa, G. et al. 2021. Furin cleavage of SARS-CoV-2 Spike promotes but is not essential for infection and cell-cell fusion. PLoS Pathog 17, e1009246.