Tagged Nucleocapsid Production Vectors
Product | Unit size | Cat. code | Docs. | Qty. | Price | |
---|---|---|---|---|---|---|
pUNO1His-SARS2-N His-tagged SARS-CoV-2 Nucleocapsid gene |
Show product |
20 µg |
p1his-cov2-n
|
|
||
pUNO1Fc-SARS-N Fc-tagged SARS-CoV-2 Nucleocapsid gene |
Show product |
20 µg |
p1fc-cov2-n
|
|
SARS-CoV-2 Nucleocapsid, codon-optimized & tagged in C-term
Schematic of tagged SARS2 nucleocapsid production vectors
InvivoGen also offers:
• SARS-CoV-2-Cellular Receptor Genes
• SARS-CoV-2-Structural Genes
GENE DESCRIPTION
The SARS-CoV-2 (2019-nCov) Nucleocapsid (N) is a phosphoprotein that associates with the viral RNA genome and forms the ribonucleoprotein core. This structural protein plays a number of important roles in the viral life cycle including replication, transcription, and genome packaging. These functions are mediated by two principal domains located at the N- and C-terminal termed NTD and CTD, respectively [1-6].
pUNO1His-SARS2-N and pUNO1Fc-SARS2-N express a codon-optimized nucleocapsid sequence fused to a C-terminal His- or Fc-tag, respectively. Both plasmids contain the nucleocapsid coding sequence from the Wuhan-Hu-1 isolate. (See Specifications for more information)
PLASMID DESCRIPTION
pUNO1His-SARS2-N and pUNO1Fc-SARS2-N are designed for the production and secretion of a tagged nucleocapsid protein. These vectors feature a potent mammalian expression cassette comprised of the strong SV40 enhancer, the ubiquitous human EF1α-HTLV composite promoter, and the SV40 polyadenylation (pAn) signal. The codon-optimized nucleocapsid coding sequence is preceded by an exogenous signal sequence to ensure effective protein secretion. Both plasmids are selectable with blasticidin in E. coli and mammalian cells.
QUALITY CONTROL
- Fully sequenced ORF
- Predominant supercoiled conformation
The native untagged nucleocapsid gene is available in the pUNO1-SARS2-N expression plasmid.
Learn more about SARS-CoV-2 infection cycle, immune responses, and potential therapeutics.
References
1. Mu, J. et al. 2020. SARS-CoV-2-encoded nucleocapsid protein acts as a viral suppressor of RNA interference in cells. Sci China Life Sci 63, 1-4.
2. Chang C. et al., 2006. Modular organization of SARS coronavirus nucleocapsid protein. J. Biom. Sci. 13:59-72.
3. Krokhin O. et al., 2003. Mass spectrometric characterization of proteins from the SARS virus. Mol. & Cell. Prot. 2:346-356.
4. Cubuk, J. et al. 2020. The SARS-CoV-2 nucleocapsid protein is dynamic, disordered, and phase separates with RNA. bioRxiv. doi:10.1101/2020.06.17.158121.
5. Kang, S. et al. 2020. Crystal structure of SARS-CoV-2 nucleocapsid protein RNA binding domain reveals potential unique drug targeting sites. Acta Pharm Sin B. doi:10.1016/j.apsb.2020.04.009.
6. Khan, M.T. et al. 2020. SARS-CoV-2 nucleocapsid and Nsp3 binding: an in silico study. Arch Microbiol. doi: 10.1007/s00203-020-01998-6.
Back to the top
Specifications
pUNO1His-SARS2-N
- Strain: Wuhan-Hu-1 isolate
- ORF (N::His): Codon-optimized 1344 bp
- Signal sequence: Exogenous (Lucia luciferase)
- Tag: C-terminal 6xHistidine (6xHis)
-
Subcloning restriction sites: 5' AgeI or NcoI and 3' NheI
- AgeI generates cohesive ends compatible with XmaI, BspEI, NgoMIV, and SgrAI
- NcoI generates cohesive ends compatible with BspHI, FatI, and PciI
- NheI generates cohesive ends compatible with AvrII, SpeI, and XbaI -
Sequencing primers:
- Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
- Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
pUNO1Fc-SARS2-N
- Strain: Wuhan-Hu-1 isolate
- ORF (N::hIgG1-Fc): Codon-optimized 2061 bp
- Signal sequence: Exogenous (Lucia luciferase)
- Tag: C-terminal human IgG1-Fc
- Subcloning restriction sites: Due to the lack of a unique restriction site at the 3’ end of the fusion gene, this plasmid does not facilitate the subcloning of the Fc-tagged nucleocapsid gene.
-
Sequencing primers:
- Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
- Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
Contents
pUNO1His-SARS2-N and pUNO1Fc-SARS2-N contain:
- 20 μg of lyophilized DNA
- 2 x 1 ml Blasticidin at 10 mg/ml
The product is shipped at room temperature.
Lyophilized DNA should be stored at -20 ̊C.
Resuspended DNA should be stored at -20 ̊C and is stable up to 1 year.
Blasticidin is a harmful compound. Please refer to the MSDS for handling instructions. Blasticidin can be stored at 4°C or -20°C for up to 2 years. The product is stable for 2 weeks at 37°C.
Avoid repeated freeze-thaw cycles.
Back to the top