Iota Variant (B.1.526) Spike Pseudotyping Vector

For lentiviral particle pseudotyping with the SARS-CoV-2 Spike (B.1.526 - New York origin) 

pLV-SpikeV6 has been specifically designed for the pseudotyping of lentiviral particles with the SARS-CoV-2 Spike (S) protein when co-transfected with plasmids encoding a reporter and accessory proteins (not provided). pLV-SpikeV6 encodes the full-length Spike sequence from the Iota variant (B.1.526), and for optimal expression, it is codon-optimized and the C‑terminal ER-retention signal has been removed [1, 2].

 More details

Iota Variant (B.1.526 lineage) Spike pseudotyping vector

Gene Description

This plasmid encodes the Spike protein from the SARS-CoV-2 Iota variant (B.1.526), first reported in New York USA in November 2020. This variant is classified as a member of Clade 21F/ B.1.526 lineage (Nextstrain/Pango lineage classification). It is characterized by the presence of mutations within the Spike coding region, of which, several are of concern [3].

• S1 domain: L5F, T95I, D253G, D614G
• RBD: E484K
• S2 domain: A701V

Learn more about SARS-CoV-2 variants

General Plasmid Description

This plasmid features a potent mammalian expression cassette composed of the ubiquitous human-(h)CMV composite promoter, a rabbit β-globin intron directly upstream of the spike gene, and a rabbit β-globin polyadenylation (pAn) signal. The spike coding sequence includes the SARS-CoV-2 signal sequence and the S1/S2 furin cleavage site [4]. These plasmids are selectable with ampicillin in E. coli.

Applications

• Generation of Spike pseudotyped lentiviral particles upon co-transfection with reporter and accessory protein plasmids (not provided).
• Screening of SARS-CoV-2 inhibitors including small molecules, monoclonal antibodies, or convalescent plasma.

References:

1. Johnson, M.C. et al. 2020. Optimized Pseudotyping Conditions for the SARS-COV-2 Spike Glycoprotein. J Virol 94.
2. Ou, X. et al. 2020. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620.
3. Annavajhala, M.K. et al. 2021. A Novel and Expanding SARS-CoV-2 Variant, B.1.526, Identified in New York. medRxiv doi: 10.1101/2021.02.23.21252259.
4. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.

Specifications

• Origin: Iota Variant (B.1.526 lineage) | New York origin
• Sequence Reference: EPI_ISL_765495
• Codon Optimized
• ORF size: 3765 bp
• Sequencing primers:
  - Forward rbt β-globin intron: TGGTTACAATGATATACACTG
  - Reverse rbt β-globin pAn: CTCAAGGGGCTTCATGATGTC
• Quality Control:
  - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
  - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.

Contents

pLV-SpikeV6 is provided as follows:

• 20 μg of lyophilized DNA

 The product is shipped at room temperature.

Lyophilized DNA should be stored at -20 °C.

Resuspended DNA should be stored at -20 °C and is stable up to 1 year.

Details

Spike-pseudotyping of lentiviral particles

InvivoGen's pLV-Spike plasmid collection has been designed for pseudotyping lentiviral particles with the SARS-CoV-2 Spike (S) protein. The S protein a structural glycoprotein expressed on the surface of SARS‑CoV-2. It mediates membrane fusion and viral entry into target cells upon binding to the host receptor ACE2 and its cleavage by cellular proteases such as TMPRSS2 [1]. Notably, the C‑terminal cytoplasmic tail of the S protein encodes a presumptive endoplasmic reticulum (ER)‑retention motif (KxHxx), which has previously been shown to enable the accumulation of SARS‑CoV S proteins at the ER‑Golgi intermediate compartment (ERGIC) and facilitate their incorporation into new virions [2]. The removal of this motif (d19) has been shown to increase the expression of the spike protein in pseudovirions [3,4].

Pseudotyped particle production involves the co-transfection of 293T cells with a reporter protein vector (e.g. GFP), one or several plasmids encoding the necessary lentiviral proteins, and the pseudotyping pLV-Spike plasmids. The transfected cells produce SARS‑CoV‑2 Spike (S)‑pseudotyped lentiviral particles, which can then be used to infect permissive cells, such as ACE2‑expressing HEK293-derived cells and ACE2‑TMPRSS2‑expressing A549-derived cells.

References

1. Hoffmann M. et al. 2020. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell. 181:1-16.
2. Ujike, M. et al. 2016. The contribution of the cytoplasmic retrieval signal of severe acute respiratory syndrome coronavirus to intracellular accumulation of S proteins and incorporation of S protein into virus-like particles. J Gen Virol 97, 1853-1864.
3. Johnson, M.C. et al. 2020. Optimized pseudotyping conditions for the SARS-COV2 Spike glycoprotein. J Virol. 94(21):e01062-20
4. Ou, X. et al. 2020. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620.